26dcarroll 26dcarroll
  • 13-10-2022
  • Mathematics
contestada

The points (6, -2) and (h, -3) fall on a line with a slope of 1/3. What is the value of h?

Respuesta :

Otras preguntas

2. Solve by substitution: y = -x + 2 AND 2x - y = -5*
Under the Constitution, the judicial branch must try criminal cases with a of one’s peers.
PLEASE ANSWER 50 POINTS AND BRAINLIEST
the speed of sound is 343m/s. dezeirey is positioned 5m behind her. how many seconds will it take for the echo from the wall to reach her​
Democracy was first practiced in which part of the world?
Spanish 1, Follow directions in pic. Brainiest if correct.
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG
What do these details help you understand Soto?
which bone layer holds calcium and other minerals
can someone tell me the answer for both of these pleaseeee i need it asap!!! i will give brainlist!!