kevinfontanilla kevinfontanilla

15-10-2022
Mathematics

contestada

Romeo walked 12 12 kilometers. If he averaged 312
kilometers per hour, how long did it take him to walk this distance?

Respuesta :

Otras preguntas

Find the quotient. 7 square root 10,669

How does Dickinson support her assertion that poetry is more expansive than prose? 1. She looks for examples of the wondrous in the world. 2. She argues that

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

If the radius of the compass is 14 millimeters, what is the approximate area of the compass? A. 87.92 mm2 B. 615.44 mm2 C. 1,230.88 mm2 D. 43.96 m

Which equation can you use to solve for x? x + 56 = 180 x + 146 = 180 180−x=146 x + 56 = 146 The figure contains a pair intersecting lines. One of the fou

In a(n) _____, the company stops the disputed behavior but does not admit that it broke the law.

Translate the following: Our house Question 1 options: nos casa su casa vuestra casa nuestra casa

PLEASE The means of mass communication such as television, radio, newspapers, and the internet, are collectively known as the ____. Question 2 options: public b

Choose the correct simplification of the expression (−21r9s3t36)0

The length of a rectangle is 7 cm less than twice its width. if the area of the rectangle is 39 cm2, find the dimensions of the rectangle.