aidenlumpkins219 aidenlumpkins219

13-11-2022
Biology

contestada

Using the following genomic sequence:

1) Underline each intron

2) Circle each exon

UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG

AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU

GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA

CAUAAU

Respuesta :

Otras preguntas

Consider polynomial function f(x) = (x+ 1)(x−2)(x−3). (a) Find all zeros. (b) The zeroes divide R into a few open intervals. Find sign of f(x) for x in each int

How do bacteria that live deep below the ocean’s surface make food? a. by cellular respiration b. by chemosynthesis c. by photosynthesis d. They eat other organ

What is (-4.8y + 20.1) - (12.7y + 9.3)?

Luanne made a photocopy of a drawing of a rectangle. The original drawing was 4.5 inches wide and 6 inches long. The copy was 6.75 inches wide and 9 inches long

Write an algebraic expression for two fifths the cube of a number

What is the nth term in the sequence: 4, 7, 12, 19, 28 Please show working out

peter made two transactions today at his bank. what can the sum -47.27 plus 598= 550.73 mean in terms of peters bank account? i need help!!

What is the slope-intercept form of 8x - y - 6 = 0? Can anyone explain how to make it step by step?

If I work then I earn money, but if I'm idle, then I enjoy myself. Either I work or I'm idle. However, if I work, then I do not enjoy myself, while if I'm idle,

Which of the following pairs does NOT represent a correct relationship? (A) glucose; polysaccharide (B) starch; polysaccharide (C) starch; carbohydrate (D) gluc