sunnyluvrena sunnyluvrena

12-12-2022
Biology

contestada

5'
GCCATATATATAATTGTGGCCATGGGGCAAGTCCCCAAGGCGACCCTATAGGGGGCG 3'
3' CGGTATATATATTAACACCGGTACCCCGTTCAGGGGTTCCGCTGGGATATCCCCCGC 5'

18. Explain the type of nucleic acid portrayed in the sequence of nitrogenous bases displayed
above?

Respuesta :

Otras preguntas

supplicate A. to give B. to answer C. to beseech D. to ignore

Which verb form correctly completes the sentence? Mr. Hernandez, helping students at the end of class, ______ to hand back the term papers. A. forgotten B. forg

Is square root of four hundred rational or irrational? Explain your reasoning.

Which word in the sentence, if any, should be followed by a comma? Our dog is a retriever which is a type of dog bred for hunting. A. bred B. There is no error

Explain the phrase "to say they are coach and wrestler doesn't begin to cover it"

round 7,298,341 to the nearest 10,000

What is the slope of the line that passes through the points (–2, 5) and (1, 11)? A. B. C. D.

Which answer choice correctly completes the sentence? Is the backpack in the hall __________? A. hers B. hers' C. her's

Which pronoun correctly completes the sentence? __________ has sent these lovely flowers? A. Who B. Whom

explain how you con use place value pattern to describe how 50 and 5000 compare