sunnyluvrena sunnyluvrena

12-12-2022
Biology

contestada

5'
GCCATATATATAATTGTGGCCATGGGGCAAGTCCCCAAGGCGACCCTATAGGGGGCG 3'
3' CGGTATATATATTAACACCGGTACCCCGTTCAGGGGTTCCGCTGGGATATCCCCCGC 5'

18. Explain the type of nucleic acid portrayed in the sequence of nitrogenous bases displayed
above?

Respuesta :

Otras preguntas

Gathering information with your eyes is called.A. central vision B. peripheral visionC. rubbernecking D. visual perceptionPlease support your answer with short

A small rectangular block of metal must be a magnet is ita. Aligns itself east west when hung up from the ceilingb. Is attracted towards a magnet c. Is made of

why is water vapor important in weather

Round 736 to nearest ten

Give the domain of f(x) = 9^(x-4) +7a.) x > 0b.) x < 7c.) x > 4d.) All Real Numbers

A balloon, whose volume at 23°C is 535 mL, is heated to 46°C. Assuming the pressure and amount of gas remain constant, what is the volume of the balloon at 46°C

how do i graph the parabolas y = 1/32x^2

You're conducting a physics experiment on another planet. You drop a rock from a height of 2.3 m and it hits the ground 1.1 seconds later. What is the accelerat

Most of the newspaper (was,were) placed in the recycling can.

Give the domain of f(x) = 9^(x-4) +7a.) x > 0b.) x < 7c.) x > 4d.) All Real Numbers