maryclare58 maryclare58

13-12-2022
Mathematics

contestada

Students in Mrs.Walker’s health class are measuring their heart rates after jogging around the gym. After 30 seconds,Kylie had counted 45 heart beats. Assume the number of heart beats y is proportional to the number of seconds x. What is the slope of the line and what is kylie’s heart beat each second?

Respuesta :

Otras preguntas

5. A recent college graduate hopes to have $200,000 saved in their retirement account 25 years from now by contributing $150 per month in a 401(k) plan. The goa

A rubber ball is held in front of a light bulb. The rubber ball casts a shadow on the wall. What happens to the shadow when the ball is moved nearer to the ligh

What was written to clarify and reaffirm many of the key doctrines of the Christian faith?

Find the measure of each angle.

A ‘flat’ line means a) Unbroken b) Not round c) Endless d) Horizontal

PLEASE HELP WILL GIVE 100 POINTS

Can some please help me. This is for an exam due tomorrow

How many moles of H2SO4 are in a 25ml sample of 0.25M H2SO4?

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

hey i am seeking friends .... co. mment down