babiibri894 babiibri894
  • 14-05-2023
  • Mathematics
contestada

If the rate at which flour is poured into a tank is given by F(t) = 36/1, in pounds per second, how much flour is poured into the tank in the first 2.5 seconds?a. 11.384 poundsb. 37.947 pounds c. 56.921 poundsd. 94.868 pounds

Respuesta :

Otras preguntas

I need help please!
Y’all can only do 4 of different dreams u have for the world Please please help help me please ASAP NO LINKS OR Files
PLS HELP ILL MARK BRANLIEST Fill in the blanks: Antonio, Carla, Miguel y Lola trabajan __________ en la mudanza. Es __________ para Antonio y Carla levantar los
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Please help I might fail math on god I’m not lyy
take thepoints keep up the hard work
Plzz help i been asking this question for way too long
Can anyone help me I will mark you Brainliest if you do
I am failing a class and my mom is having a conference with the teacher who is failing me but it's partially my fault because i didn't submit some assignments!
What are some Emerson transcendentalism values/ ideas?