yamirkarodriguez yamirkarodriguez
  • 15-05-2023
  • Mathematics
contestada

Paquita has 63 index cards. She uses
57 of them for a project. How many
index cards does Paquita have now?

Respuesta :

Otras preguntas

in the yearbook class there are 27 students. there are twice as many females then males.. how many males is there in the classroom
what is the value of 3-(-2)​
What is 3 times the sum of x plus 2 is less than 10 as an inequality?
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
After 184.5 years, onky 0.625 grams of an original 20 gram sample of a radioactive isotope is left. Find the half life​
Windows includes ________ settings, which provide a centralized location for assistive technology and tools.
Which of these is usually true of a convenience sample
Factor completely 8x^2 − 4x − 84. 4(2x − 3)(x + 7) 4(2x + 3)(x − 7) 4(x − 3)(2x + 7) 4(x + 3)(2x − 7)
If you stand next to a wall on a frictionless skateboard and push the wall with a force of 50 N , how hard does the wall push on you? Express your answer to two
4/7x + 6/7= -2/7. ​