snowflower1919 snowflower1919

15-01-2024
Mathematics

contestada

The area of a rectangular field is 6600 m^2.
If the length of the field is 88 m, what is its width?

(b)The perimeter of a rectangular painting is 252 cm. If the width of the painting is 57 cm, what is its length?

Respuesta :

Otras preguntas

You discover a hard drive is not being optimized on an automatic schedule. Before you run the optimize drive tool, why should you first run disk cleanup? How do

The condensation temperature of a material is the temperature at which the material makes a transition between being a vapor and being a solid. Three of the mos

Economies of scale Grupo de opciones de respuesta Exist in both the short run and the long run. Explain why average total costs decline as output

MacDonald Products, Inc., of Clarkson, New York, has the option of (a) proceeding immediately with production of a new top-of-the-line stereo TV that has j

If a quadrilateral is a ______________________, then each _______________________ intersects the other ________________________ at its ______________________. B

You manage the IT department at a small startup Internet advertiser. You need to set up an inexpensive system that allows customers to see real-time statistics

You are training for a marathon. You spend all your extra time conditioning and practicing, because you know that the more effort you put in, the more likely yo

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

how do u say i like you very much in spanish?

Assume the spot market exchange rate for $1 is currently A$1.1904. The expected inflation rate is 3.3 percent in Australia compared to the U.S. rate of 2.8 perc