madcoope8230 madcoope8230

14-02-2024
Mathematics

contestada

What is the product of (-3)² and (-3)³?
A) (-3)⁵
B) (-3)⁶
C) (-3)⁷
D) (-3)⁹

Respuesta :

Otras preguntas

Imagine a day or a week in which you accomplish everything you want while maintaining a comfortable degree of stress and a nice sense of balance. What would you

Chloe drives from her house to her Grandma's house 48 miles away in an hour and 12 minutes. How far could she travel in 9 minutes? Group of answer choices 24 mi

If you had to choose dog or cat what would you choose? 1st to answer is brainliest and if you can’t answer after 2 people then just commment I’m making a pie ch

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

CHEMISTRY!! Please help!!

what is the perimeter of the entire design

This battle was near Brownsville on the coast of Texas and was the only battle not involving gunships. Battle of San Jacinto Battle of Galveston Battle of Sabin

what is one major accomplishment of the neutralists

The Senate and the House of Representatives can override the President's veto by blank vote A majority B 3/4 C 3/5 D 2/3

Question 2 Karaline wants to attend a summer camp in Georgia. She needs to earn $750 to pay for camp. So far, Karaline has earned 8% of the amount needed. How m