antboogie3746 antboogie3746
  • 14-02-2024
  • History
contestada

What was the main reason for reconstruction after the Civil War?
1) To help the freedmen
2) To help the southern economy

Respuesta :

Otras preguntas

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5
Simplify the expression: -13(6x + 15) - 3
You do an experiment in which you use acetyl-CoA with 14C label on both carbons of the acetyl group. You let this run through one round of the citric acid cycle
(Please answer ASAP) (Will award Brainliest)What is one role of the U.S. Treasury?-Approve the federal budget-Approve federal deficits-Issue securities-Issue pe
La versión de 2009 de Corazón salvaje sufrió un del 40%. Question 2 with 1 blank Yo soy Betty, la fea aparece en el Libro Guiness como la telenovela más de la
PLEASE HELP!!! ASAP!!! Find the roots. (show all steps of work, check each answer, and state the solutions correctly for full credit) y = x2 – 8x + 15​
You are the lucky student of a wacky professor who develops a time machine. He asks if you will test it with him. You get in and there is an immediate glitch–th
14. While sailboarding, Jolene is injured when Kirby carelessly crosses her path. Kirby’s insurance company offers Jolene $50,000 to release Kirby from liabilit
The current governor of Indiana is what
Comfy Inc. uses five yards of wool in each blanket it produces. Comfy’s production budget next year is 30,000 blankets. The anticipated wool inventory at Januar