baseballboss8506 baseballboss8506

13-03-2024
Mathematics

contestada

Find the derivative of the function y = tan⁻¹ (4x) .

Respuesta :

Otras preguntas

What three factors that can affect population size?

Given a sequence is defined by the explicit definition t_n= n^2+nt n = n 2 + n, find the 4th term of the sequence. (i.e. t_4t 4) A. 4B. 8C. 20D. 1806

The record time for running the Boston Marathon is 2.12 hours at an average speed of 12.5 miles per hour. What distance does the Boston Marathon approximately c

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

2/4 foot =how many inches

Which of the following qualities is important for a team member to have? A-Active Listening B- Positive Attitude C-All of the above

The Cumberland Gap is part of which of the following? a. the Atlantic Ocean b. the Appalachians c. the Ohio Valley d. the Hudson River It's not the appalachi

A theater has a seating capacity of 750 and charges $2 for children, $4 for students, and $6 for adults. At a certain screening with full attendance, there were

A helicopter is lifting two crates simultaneously. One crate with a mass of 160 kg is attached to the helicopter by cable A. The second crate with a mass of 73

somebody ------- my keys. 1. stole 2. has stolen 3. have stolen