pinktigerpop70701 pinktigerpop70701
  • 13-03-2024
  • Biology
contestada

Replicate the following gene strand, and then transcribe the template strand:
GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter abbreviations for the amino acids
(if you do it correctly it should spell something).

Respuesta :

Otras preguntas

Determine the second derivative of y=cosxtanx. Thanks :)
Which word correctly completes the sentence? My aunt keeps track of many family __________ birthdays.         A. members'       B. member's
Which structural adaptation would help a plant survive better in a shady environment? A. thorns B. small leaves C. large leaves D. brightly colored flowers
Factor the expression 3x3 + 2x2y + 3xy2 + 2y3
Find the domain and range of function y = √(−x^{2} −6x+2)
What is Robert F. Kennedy`s main purpose in his speech about Martin Luther King`s assassination?
Why did the Bonus Army march on Washington D.C.?
Which of the following has the most electrons? A) Sr^{2+} B) Rb C) Cl^{-} D) Kr
why did the Roman Empire fell
Solve and check 14=2/3(9y-15)