guardhic1700 guardhic1700
  • 15-03-2024
  • Mathematics
contestada

A product is sold at two consecutive discounts of 30% and subsequently 40%. if the product is sold for 1500, what is the marked price on product?

Respuesta :

Otras preguntas

Attraction without closeness is callled a(n) ____
“Procuring” something refers to: A. carefully obtaining it. B. meticulously maintaining it. C. diligently recording it. D. scrupulously transcribing it.
giving brainliest!! easy*
the locus of points in a plane
In at least one hundred words, describe the impact of the Vietnam War upon the literary scene in America.
The Hunger Games Answer these questions: What happens in the scene?
what is the mRNA in TACCGGATGCCAGATCAAATC?
Need help quick please
How important is the role of media based arts in this time of pandemic?
Jenny's company has 15 trucks in two different sizes. There are small trucks with 6 wheels and large trucks with 12 wheels. Her company needs to inspect the 108