rainbow4937 rainbow4937

15-04-2024
Computers and Technology

contestada

An entity that is a member of a subclass inherits all attributes of the entity as a member of the superclass.
A)true
B)false

Respuesta :

Otras preguntas

TIME SENSITIVEThe range of [tex]y= \frac{4}{5} sinx[/tex] for [tex] \pi \leq x \leq \frac{3 \pi }{2} [/tex] is _____.

What did the United States Constitution do? A. created procedures to end slavery B. created a national government C. organized a time line for independence D. m

The overall purpose of continuing the Civil War to address the issue of slavery rested on a document written by President Lincoln called the _____.

Which war led to the ratification of women’s voting rights, as it was the first time women were significantly involved in the war effort? Civil War World War I

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Which of the following was built by Tennessee Valley Authority? A. dams B. highways C. public buildings D. national parks

Which sentence in this excerpt from "Common Sense" by Thomas Paine proposes that the American colonies should be neutral in their relationships with foreign nat

In the ouchterlony test, if an unknown antigen contains only swine serum albumin, how many precipitin lines will form between it and the wells of antibodies for

why did the Bolsheviks rename their party the Communist Party?

What effect does changing the function f(x)=1/2 sin(x)+2 to the function g(x)= 2 sin(x)+8 have on the graph of f(x)? The graph is vertically stretched by a f