ninaa7
ninaa7 ninaa7
  • 12-06-2018
  • Mathematics
contestada

please help me find the slope of the line !!

please help me find the slope of the line class=

Respuesta :

cherrynerd cherrynerd
  • 12-06-2018
The slope of the line is 3/2. That would be letter B. You take two points from the graph and subtract them from each other to find the slope. Hope this helps!
Answer Link

Otras preguntas

Which of the following can be used to prove that the triangle EFG is a right triangle.
On a skiing trip there are five people but only three pairs of skis how many different groups of three could ski
Every world religion contains elements of doctrine, worship practices, and ethics. a. True b. False
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Every world religion contains elements of doctrine, worship practices, and ethics. a. True b. False
did the watergate scandal increase or decrease the trust in government?
When gathering evidence, the writer should A. start with a strong closing. B. provide a hypothetical solution to a problem. C. read the article
Use logarithms to solve each equation 2x 9/8=111 A. 18.9561 B.25.8961 C. 10.2587 D. 35.5208
how does assertive communication treat both you and the person you’re talking to ?
Read the excerpt below and answer the question. Now let us sport us while we may; And now, like am’rous birds of prey, Rather at once our time devour, Than lan