luqman99204 luqman99204

14-06-2018
Computers and Technology

contestada

how long will 13 gb take to download if it is going 400kb/s

Respuesta :

fuadsafeer1 fuadsafeer1

14-06-2018

Approximately 10-20 Minutes

Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

What appliance in a house uses the most natural gas or electricity? Please respond quick!

Henry is an excellent cook and wants to start a food truck to sell burgers. Which type of commercial food service operation does Henry want to start? full servi

How and when did the Cold War come to and end? I will mark brainliest answer to the best explaniation and answer ~!King!~ Thanks for your help

The scouts sold small and large boxes of cookies as a fund raiser. One scout sold 7 small boxes and 12 large boxes for $54.00. Another scout sold 5 small boxes

Describe the disaster at Chernobyl.

Using the arrows given below, complete the molecular orbital occupancy for b. do not leave any boxes unfilled.

How does the structure of paragraph 2 help the writer make an effective argument

you have 4 friends go to a concert. in how many different was can you sit in the assigned seats?

The primary sugar in milk and dairy products is... A) lactose B)sucrose C)maltose D)fructose