Lizronaldo Lizronaldo

12-03-2016
Mathematics

contestada

Which answer shows this equation in standard form?
6 – 2(x – y) = –3x + 5
A.
x + 2y = –1
B.
x + 2y = 1
C.
x – 2y = 1
D.
–5x + 2y = –1

Respuesta :

SmarticalParticals SmarticalParticals

12-03-2016

6 - 2(x-y) = -3x + 5
6 - 2x - 2y = - 3x + 5
6 - x - 2y = 5
-x - 2y = -1
x + 2y = 1

Your answer is B

Answer Link

Otras preguntas

How to do Fill up of this Sentence Answer from this Sentence

dude I don’t even know anymore

Round off 631 to the nearest 100 And also round off 8348 to the nearest 100

Can somebody please help me!!

Find the missing side and angle to the nearest tenth. AC= m∠B =

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Which of the following shows that the Whitmans did not understand the Native Americans? O The Whitmans built and maintained a house among them in which they he

Can someone help me pls

mention 4 impacts of toxic relationship on setting life goal

Is this correct solution?