javoncwynnp58934 javoncwynnp58934

11-09-2018
English

contestada

Which type of figurative language uses the words like or as to express a comparison between two things? A. Assonance B. Personification C. Metaphor D. Simile

Respuesta :

tmntpat tmntpat

11-09-2018

a simile uses like or as

Answer Link

Otras preguntas

How many moles of H 3 PO 4 are produced when 20.0 g of HCI are produced by the reaction PCl 5 +4H 2 O H 3 PO 4 +5HCl ?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Can someone help me solve this question.

The price of a watch was increased by 20% to £162. What was the price before the increase?

explain economics in your own words

A good credit score means you will be able to get what? (Select the best answer.) A credit history A lower interest rate A default A higher interest rate

If 8 minus some number divided by 3 = 6 what is the number?

Which of the following circumstances contributed to the fall of Rome? A. economic weakness B. inadequate and poorly trained military force C. inadequate trade D

2 The Lee family drove 450 miles in 6 hours. If they drove at this rate of speed the entire time, how far did they go in 4 hours? birto the

area of right triangle