tammypierce tammypierce
  • 14-09-2018
  • Mathematics
contestada

18+24+3+4x6=6x(4+6)=____+_____

Respuesta :

bethanynhall9046
bethanynhall9046 bethanynhall9046
  • 14-09-2018

One option for the answer would be -(9+9)

Answer Link
zhenzhen zhenzhen
  • 14-09-2018

-(9+9) this is the correct answer

Answer Link

Otras preguntas

Hi! I have no idea if I did this question right something feels wrong. Can anyone help me? Thank you a lot!
Please help I was sick and missed out on class.Thank you
What was the significance of Reaganomics?
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
If a farmer wants his irrigation system to cover an area of 2 square miles, and his sprinkler rotates through 50 degrees, what is the diameter of his circular
The population of California was about 37 million in 2010 and increasing by 1.0% each year. Create a formula to estimate the population of California in 2020.
Add my sn ap djrogers2004
13. Which word in this sentence is an adjective, and which word does it modify? The grateful man warmly thanked the woman who had helped him. The adjective is g
Solve 2y + x + 3 = 0 and 3y - x + 1 = 0 graphically using -4 ≤x ≤ 2help pls​
The diagram shows a non-uniform beam of weight 120 N, pivoted at one end. The beam is kept in equilibrium by force F. pivot 20 cm What is the value of force F?