alahiarellano alahiarellano
  • 16-10-2018
  • Mathematics
contestada

John bought six baga of gummy bears and paid a total of $13.75, including tax. If each bag costs $2.25, how much tax did John pay?

Respuesta :

AaronWiseIsBae
AaronWiseIsBae AaronWiseIsBae
  • 16-10-2018

First let’s figure out the total cost of the gummy bears

6 x 2.25 = 13.50

Okay, so now we know that John paid 13.50 for just the gummy bears

If the total cost was $13.75, therefore, that would make the tax $0.25

Hope this helps you

Brainliest would be appreciated!

-AaronWiseIsBae

Answer Link

Otras preguntas

Which of the following delivers oxygen to the body? Mark all that apply Arteries Veins Capillaries Hemoglobin
36 POINTS In the ______, President Lincoln declared all slaves who lived in s
Which image would best support the point that students can have fun volunteering with senior citizens in their community?
What does “human-like” mean when we are talking about a machine?
When I'm renting someone else's place, I really have to take care of it, unless I want to throw away a lot of money
A company is hosting an event for its employees to celebrate the end of the year. It asks the employees whether they prefer a lunch event or a dinner event. It
Ribosomes o break down sugar for energy o produce proteins for the cell package and distribute proteins
Mervon Company has two operating departments: mixing and bottling. Mixing occupies 27,235 square feet. Bottling occupies 14,665 square feet. Indirect factory co
A) 7.2 cm B) 9 cm C) 10.6 cm D) 12 cm
Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG