melissasalinas85 melissasalinas85
  • 15-11-2018
  • Mathematics
contestada

Brainlist plsss help Why do we pay taxes and how is this money spent

Respuesta :

Аноним Аноним
  • 15-11-2018

The federal taxes you pay are used by the government to invest in technology and education, and to provide goods and services for the benefit of the American people. The three biggest categories of expenditures are: Major health programs, such as Medicare and Medicaid. Social security.

Answer Link

Otras preguntas

what is the numerical equivalent of setenta y seis
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
73÷20 ,291 ÷ 30 can you help ☺
Write 2/3 of 4 as a fraction
A lotion is made from an oil blend costing $1.50 per ounce and glycerin costing $1.00 per ounce. Four ounces of lotion costs $5.50.
How to work out 215 in a fraction
Given that and , determine which lines are parallel
2x+4y=22, 2x-2y=-8 solving systems using elimination. can you please solve and show your work
Structural changes brought on by the Industrial Revolution had major consequences for families. What was one of the primary mechanisms that explains these cons
Which of the following statements is NOT true about Isabella d’Este? A. She was considered a true Renaissance woman because she was a doer and a thinker. B.