aliciajuarez aliciajuarez

12-01-2019
History

contestada

Which minority group was the most affected by the massive migration of MidWestern farmer to the Southwest?
1.Mexican immigrants
2.Native American
3.African Americans
4.Irish Americans

Respuesta :

lyfonses lyfonses

12-01-2019

The answer to this question is :
1. Mexican immigrants

Answer Link

Otras preguntas

When you run to catch a ball, your movements are planned and controlled from the?

Graph this function y-2=-(x+5)

What does the text say that the primary advantage of the north over the south was?

¿Qué es un PC? a. computadora personal b. campana personal

Need help ASAP please

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Hindu beliefs and practice have been preserved through an oral tradition and expressed in texts and hymns known as the:

Joe knows a 5-pound turkey breast will feed 8 people. If 20 people are coming to Joe's home for dinner, at this rate how many pounds of turkey breast will he ne

How is carbon dioxide removed from the atmosphere

Order this number smallest to biggest -2,-4,-6,-0.22,-0.44