molinatony238 molinatony238
  • 14-08-2019
  • Health
contestada

How to social environments affect a persons well being

Respuesta :

jada2495
jada2495 jada2495
  • 17-08-2019
Poor social and economic circumstances affect health throughout life. ... Social and psychological circumstances can cause long-term stress. Continuing anxiety, insecurity, low self-esteem, social isolation and lack of control over work and home life, have powerful effects on health.


OR IS IT MULTIPLE CHOICE?
Answer Link

Otras preguntas

How high is a tree that casts a 24​-ft shadow at the same time that a 6​-ft fence post casts a 6​-ft ​shadow?
What is the equivalent faction to 2/5
There are fewer than 9 gallons of gas in the tank. Use f as your variable
Amanda and ben are in different statistics classes. amanda scores a 15 on a quiz. her classmates have a mean of 20 and the standard deviation of 5 on the quiz.
What is the y1 of 3x-5y=20
If y= 3x + 6, what is the minimum value of (x^3)(y)?
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Identify the there parts of the Financial system.
A PET scan can study of people with found increased activity in the amygdala
Based on "Civil Disobedience," what statement did Thoreau, like his modern-day successors, hope to make with his imprisonment? a. He wanted to show the great un