Tyjay04 Tyjay04
  • 16-10-2019
  • History
contestada

How the study of soils has changed our world

Respuesta :

iifeless
iifeless iifeless
  • 16-10-2019
The study of soil has changed our world because soil filters our water, provides needed nutrients for our plants and forests. It also helps regulate Earth’s temperature as well as many greenhouse gases.
Answer Link

Otras preguntas

Choose four wordsdescribing growing food
please help i’m so confused LMC of 9, 12 and 24
Before creating an artist's statement about a piece of clothing you created, which would you have to do first? A)Show your project to as many people as possible
Please help y’all 50 point Directions: After reading both documents, you must decide which Essay prompt you believe fits the documents best and why. Essay Pro
50 points !!!! Pls help me
find the area of the squarewhose perimeter is 224cm​
Factor out the GCF from the given polynomial. 10^3 + 16^2 - 18x 10^3 + 16^2 - 18x = (Type your answer in factored form.)​
Which statement best describes the underlying reason for Andrew Johnson’s impeachment? a. He appointed corrupt cabinet members and ignored their illegal activit
The time needed to complete a final examination in a particular college course is normally distributed with a mean of 79 minutes and a standard deviation of 8 m
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein