arielsutton arielsutton

12-11-2019
Mathematics

contestada

what is the answer of 7% to the number of 78 of the percent

Respuesta :

13-11-2019

Answer:

7% of 78 is 5.46

Step-by-step explanation:

Given number = 78

We have to find 7% of 78 So:

= 7/100 * (78)

= 0.07 (78)

= 5.46

So 7% of 78 is 5.46

i hope it will help you!

Answer Link

Otras preguntas

What causes ocean water near the equator to be warmer than ocean water farther north

Jose Marti no vivió en

Write a point-slope equation for the line that has slope 1.4 and passes through the point (21, 5). Do not use parenthesis on the y side.

Now it’s time to write about what you believe about the First Amendment. Here is your topic: Should students be able to criticize their school in the school n

solve by elimination method 7x+5=-2

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

HAALLP We the People of the United States, in Order to form a more perfect Union, establish Justice, insure domestic Tranquility, provide for the common defense

The fed serves the public. True or false

In what way did the united kingdom, france, and the soviet union deal with germany similarly in the years before world war II

Why was the blitzkrieg was successful in Poland