natelewis7272 natelewis7272

14-11-2019
Physics

contestada

A calcium bromide compound is represented by which formula?

Respuesta :

Faithaghoorees Faithaghoorees

14-11-2019

Answer:

Calcium bromide is the name for compounds with the chemical formula CaBr2(H2O)x.

Answer Link

ebe9443382 ebe9443382

23-01-2020

option D) CaBr2

hope this helps

Answer Link

Otras preguntas

Doing a word search puzzle. The question is: a single building block

A store owner mixes 2 lb of candy that cost x dollars per pound with 3 lb of candy that costs $1.50 per pound. She sells the mix for $2.50 per pound. 1. How mu

1. (01.01 LC) Which of the following is a flat surface that extends infinitely, has length and width, but does not have depth? Angle O Circle O Plane Segment

Select ALL the correct answers.This graph shows a proportional relationship between students Kyla tutors and the number of weeks.

How does "Do Not Go Gentle Into that Good Night" fit within modernist trends? How does it not fit within modernist trends?

What is the complete factorization of 6x2 + 9x - 6? A. 3(2x - 1)(x + 2) B. (3x + 2)(2x - 3) C. 3(x-2)(2x + 1) D. 3(x-2)(2x - 1)

Answer the questions below that refer to the following system of equations. y = −x + 1 y = 2x + 7 a. Graph the system on graph paper. Then write its solution (t

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

What impact can family therapy have on a family with an alcoholic member?

10) Refer to the excerpt from "Democracy in America." Then, choose the best answer. Use a dictionary resource for any words you do not understand. When figuring