drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

Can someone tell me the right answer to this question plsss and thank you

find the exact value of cos 5pi/3

Solve the word problem. The formula d = rt gives the distance traveled in time t at rate r. A bicyclist rides at a constant rate of 15 miles per hour. How many

HELP ME PLEASEE!!!!!! if one side of a field is 2xy^3 feet long and the other side is 3x^2y whatis the area of the field

What is the solution for this inequality? 8x ≤ -32 A. x ≤ -4 B. x ≤ 4 C. x ≥ -4 D. x ≥ 4

28/35 in lowest terms

1. Which of the following are considered careers in government public service? Select all that apply.

how to get 104 using only 2, 3, 5, and 8

?De dónde eres? Ella es de Guatemala. Nosotros somos de Guatemala. Soy de Guatemala. Tú eres de Guatemala.

why did the north win the civil war?