bluechicken1748 bluechicken1748

11-12-2019
Mathematics

contestada

im not quite sure on how to do this plz help..... :3

Respuesta :

jinchengzhaoliii jinchengzhaoliii

11-12-2019

Answer:

is there supposed to be an attachment?

Step-by-step explanation:

Answer Link

Otras preguntas

Comment les adjectifs irréel et surnaturel sont-ils formés ?

The table shows the proof of the relationship between the slopes of two perpendicular lines. What is the missing statement in step 2?

dentify each part of your writing assignment. Topic: What will you write about? Purpose: Why will you write?

Two tracking stations are on the equator 163 miles apart. A weather balloon is located on a bearing of N 43°E from the western station and a bearing of N 17°E f

How do you solve this problem step-by-step? 15(40-9)x3+6

Can someone please help me with this. (15pts.)

The population of California was about 37 million in 2010 and increasing by 1.0% each year. Create a formula to estimate the population of Cal

What two things were distinct about clothing in every region?

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Calculate the amount of paint needed to paint the front of this building knowing that 0.5 kg of paint is needed per m^2