leadinghamhaley1077 leadinghamhaley1077
  • 14-01-2020
  • Social Studies
contestada

Created to serve as perfectly as possible their workaday ______, the wooden storage boxes made in America’s Shaker communities are now _____ for their beauty.

Respuesta :

nalleitenw
nalleitenw nalleitenw
  • 14-01-2020

The correct answer is function; valued

Explanation: Created to serve as perfectly as possible their workaday function, the wooden storage boxes made in America’s Shaker communities are now valued for their beauty.

Answer Link

Otras preguntas

Is Denny justified in feeling betrayed by Rita? Why or why not?
A spinner has 2 congruent sectors coloured blue and green. The pointer is spun once, and a coin is tossed. Find the probability of each event: a) blue and tails
_________ is your book
A train leaves Miami at 4:00 PM. A second train leaves the same city in the same direction at 8:00 PM. The second train travels 124mph faster than the first. If
Mention any two life domains which will help you when choosing a career?​
Why did japan join ww2
Which statement about the mass of a falling object is correct? A.It decreases as the object falls. B.It increases as the object falls. C.It is equal to the weig
1. who were the conquistadors? 2. what do most latin american countries have in common? 3. name five things spread by the columbian exchange. 4. what was the mo
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
hi everyone friends please can be follow please​