hkrueger553 hkrueger553

16-01-2020
Spanish

contestada

Describe some friends and family members and your relationships with them.
(This is for Spanish)

Respuesta :

Yadootboy Yadootboy

17-01-2020

What exactly do you need help with?
Do you want it translated?

Answer Link

ceciliatoscano043 ceciliatoscano043

17-01-2020

Mi amiga Jimena es alta y tiene el pelo oscuro . Tengo una hermana mayor que yo y está en la universidad de Ball State.

Answer Link

Otras preguntas

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

WILL MARK BRAINLIEST! PLEASE HELP MEH!Use the relationship between the angles in the figure to answer the question. Which equation can be used to find the valu

helppppppppppppppppppppppppppppppppppppppppppppppp

What is the maximum wavelength a photon can have if it is to possess sufficient energy to cause this dissociation?

A shopper needs 48 hot dogs. The store sells identical hot dogs in 2 different sized packages. They sell a six pack of hot dogs for $2.10, and eight-pack of hot

Which of the following is NOT a source of energy used by living things? a. chemical energy c. mechanical energy b. solar energy d. wind energy

How much will be left after 24 hrs if it’s half life is 6 hours?

¿Adónde encuentras gangas de artesanías de países latinos?

NEED HELP ASAP failing

On a 30-day easy-access loan, $1350 is borrowed at a 20% monthly fee. What is the total cost to repay the easy-access loan?