mg185102 mg185102
  • 11-02-2020
  • Mathematics
contestada

Find (f -9)x).
f(x) = -3x + 2
g(x)= x2

Respuesta :

tonyrini0608
tonyrini0608 tonyrini0608
  • 11-02-2020

Answer:

29 and -18

Step-by-step explanation:

f(x)= -3x+12

f(-9)= -3(-9)+2

f(-9)= 27+2

f(-9)= 29

g(x)= x2

g(-9)= -9(2)

g(-9)= -18

Answer Link

Otras preguntas

Evaluate 3/7r + 5/88 when r=14 and 8=8
In tuck everlasting what deed did the stranger want
A. Define supply as an economist would. B. List and explain three (3) non-price factors that will shift the supply curve. C. If the cost of production of founta
Express the following as Decimal place 75%
Which measure is most appropriate to describe the center of the data in the stem-and-leaf plot below? Pounds of Food Collected 056 1 0 2 3 3 4 19 interquartile
this part of the stomach contains thick muscle to mix the food and move the food into the duodenum. it is called _____.
Alina received $60 in the mail from her grandparents to buy whatever she wanted. She decided she could spend all of it on 4 t-shirts. On the other hand, she cou
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
A teacher believes that whatever he says in class has no effect on his students. Just as he's about to quit his profession, a statistician enters the room and s
Consider the following list of transactions: Repay borrowing from the bank, $2,000. Pay employees’ salaries of $1,500. Purchase equipment for cash, $10,000. Pro