toheebrasak toheebrasak

15-02-2020
Physics

contestada

show the moment of force is dimensionally equivalent to work

Respuesta :

fernandezcynthia846 fernandezcynthia846

15-02-2020

Answer:

Here, force is said to possess one dimension in mass , one dimension in length and (-2) dimension in time

Answer Link

Otras preguntas

Which expression can be used to find 1/2 of 12

Which of the following statements best represents the pros and cons of being a solitary artist? Solitary artists have complete control over the creation, produc

according to my teacher "there is not motion becuase there is no applied force" is wrong

Use your selected character Joseph from refugee to Write an essay identifying the universal aspect of the refugee experience. HELP!!! quickly please

How did the technological inventions during the American and French Revolutions have a positive impact on people? Provide examples.

What is something you really want for Christmas? <3 :)

Rebekah is studying a molecule and trying to determine if it is DNA or RNA. Which kind of molecule is she studying? carbohydrate protein nucleic acid lipid

HELP! In an official meeting the leader does NOT require a MOTION or SECOND to make a decision on behalf of the group. True False

Turning the canoe into kettle drums.” Which type of figurative language is used in this line?

Replication, Transcription, and Translation Chart Please answer DNA Replication: 1。Template Strand: Start with this nucleotide chain. TACCCTTGAATAAAAAATCTCTGTTT