josephdefort42 josephdefort42
  • 15-04-2020
  • History
contestada

What states does Lincoln designate

Respuesta :

Megaannnnnnnnnnnnnnn Megaannnnnnnnnnnnnnn
  • 15-04-2020

Answer:

On September 22, 1862, Lincoln said that in 100 days, he would free all slaves in areas not then under Union control. On January 1, 1863, he named the ten states in which the proclamation would then apply: Texas, South Carolina, North Carolina, Georgia, Alabama, Mississippi, Arkansas, Virginia, Kentucky, and Louisiana.

Explanation:

Answer Link

Otras preguntas

what is the answer too 1/14 x 9
A triangle is shown with its exterior angles. The interior angles of the triangle are angles 2, 3, 5. The exterior angle at angle 2 is angle 1. The exterior ang
Write a function in any form that would match the graph shown below 
20 points to whoever answers this asap <3 Joe and Andrew shot baskets in a school fair. Joe made 9 baskets, which is 2 baskets more than Andrew. Supply the c
4 tons of fertilizer cost $7,440.00. What is the price per pound?
Sheryl creates a scatter plot to analyze how an increase in the outside temperature above 52°F affects the sale of hot chocolate at her shop. The line shown on
How do the expressions 2q^2-3p and 2(p+q)/q Compare when p=8 and q=4? Answer with a symbol :)
can someone help me figure out how to solve this problem
12 sugar syrup using 5g sugar
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated