Anayaley27 Anayaley27

11-05-2020
Mathematics

contestada

Which number is a factor of the prime factorization of 60?
3
15
9
6?

Respuesta :

jayakexmart6706 jayakexmart6706

12-05-2020

Answer:

It’s 5

Step-by-step explanation:

Just search up on browser

Answer Link

Otras preguntas

A Local Trampoline Park requires You to Purchase Special Socks for $2.50 As a One Time Charge. It Then Costs $14.50 Per Hour. Over the Course of four weeks, Kam

Can someone help me pls

The regular pentagon shown has an apothem with a length of 2 centimeters. To the nearest tenth, what is the area of the regular pentagon in square cintimeters

Which one is correct?

What happens if law enforcement does not follow proper crime scene procedures?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

you could ask yourself what is the most painful thing in love and u might say losing them but thats not true the most painful thing is losing yourself in the pr

Find the value of x.

HELP ASAP photo attached

what is einsteins theory of relativity?