rosalia2020 rosalia2020
  • 12-05-2020
  • Biology
contestada

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Respuesta :

samchavez8277
samchavez8277 samchavez8277
  • 18-05-2020

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

Answer Link

Otras preguntas

a student dissolved a salt in water and observes that the temperature of the solution increases. if some of the salt is stuck to the weighing dish and is not tr
Why do third parties usually not last very long in the American two-party system?
On December 12, Lowell Corporation accepted a $160,000, 120-day, non-interest-bearing note from Able.com. What is the maturity value of the note?
which sentence most cleary describes genre
Which number line shows the solution to the inequality 5 ≤ 8-3x ≤ 14?
What are the zeros of the polynomial function f(x) = x3 + 9x2 + 20x? (5 points) 0, −5, −4 0, −5, 4 0, 5, −4 0, 5, 4
Which two statements explain why most American Indians initially supported the French in the French and Indian War? The French expected the American Indians to
I need help with number 11 - 16
[tex]3-\sqrt{x} =x[/tex]
2 digit by 2 digit multiplacation 97x57