rosalia2020 rosalia2020
  • 12-05-2020
  • Biology
contestada

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Respuesta :

samchavez8277
samchavez8277 samchavez8277
  • 18-05-2020

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

Answer Link

Otras preguntas

what was the german enlightenment?
What it is the quadratic formula ?
I got 60 right out of 110 questions on a test. What was my overall grade/percentage?
Which of the following expressions represents 24C12? A) 12!/24! B 24!/24! C) 24!/ 12!•12! D) 24!/12!
Can someone make the numbers 1 to 50 a perfect square?
could you tell me what is nonfiction?
Need help.I 2x +1 I < -4
I suck at math so I need help :(
My neighbour has lived all over the world. I asked how old are you? He said " I lived 1/4 of my life in China, 1/6 of my life in Vietnam, 1/2 of my life in Camb
a 22 foot ladder is placed against a vertical wall of a building with the bottom of the ladder standing on level ground 16 feet from the base of the building. h