rosalia2020 rosalia2020

12-05-2020
Biology

contestada

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

Respuesta :

samchavez8277 samchavez8277

18-05-2020

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

Answer Link

Otras preguntas

Capitalism has evolved into mercantilism throughout the world. True False

Solve: 62x - 3 = 6-2x+1x = -1x = 0x = 1x = 4

✹ BRAINLIEST WILL BE CHOSEN ✹ Match the author to the literary work.

Determine the height of the triangle. Round to the nearest foot.a. 12 ft c. 10 ft b. 14 ft d. 18 ft Please select the best answer from the choices provided

What should a potential employee consider before agreeing to a contract? a. Salary b. Benefits c. Pension d. All of the above

What is the concentration, in grams per liter, of a solution prepared by dissolving 0.00040 mol HCl in 2.2 L H2O? Assume that the volume of the solution does no

HELP In paragraph form explain how this is bias:

whats the french word for bread?

1. ¿Cuál es el propósito del artículo? Convencer a los lectores de que existe el fenómeno del calentamiento global Ofrecer varios puntos de vista sobre el tema

A square is cut in half on the diagonal, creating two equal triangles. each triangle has an area of 0.32 square units. what is the side length, in units, of the