coconutO coconutO

13-05-2020
Mathematics

contestada

A bag contains 3 pennies, 2 nickels, 1 dime, and 1 quarter. Jason will draw one coin from the bag. How many type of coins are in the bag?

Respuesta :

paytonlaisy paytonlaisy

13-05-2020

Answer:

There are 4 types of coins in the bag

Step-by-step explanation:

pennies are 1, nickels are 2, dimes are 3, and quarters are 4.

Answer Link

Otras preguntas

10x + ½ = 20 ½ Answer to this for 15 Points

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

"in the cores of extremely hot red giants, nuclear reactions convert helium to ____.

Which statement accurately describes what happened in a number of European countries in the 1800s as a result of the influence of the French Revolution?

4 1/4 divided by 1 1/2

What is the measure of <2?

Everfi module 8 which type of password would be considered secure

Who’s efforts in the 1940s and 1950s nearly eliminated polio?

if Ross earns a 5% commission on what he sells, how much he earn on $60.

both ap and dual enrollment courses share all these characteristics except that: .A. they boost the GPA on your high school transcript. B. they impress col