biancacruz2424 biancacruz2424

13-05-2020
History

contestada

Was trench warfare effective in ending the war quickly? Why or why not?

Respuesta :

13-05-2020

Answer:

It was not

Explanation:

It lead to a stalemate due to soldiers digging trenches to hold ground which also made it harder to take large amounts of ground

Answer Link

Otras preguntas

0. An applied force of 60 N is used to accelerate a 50 N object to the right across a frictional surface. The object encounters a 20 N of friction. Determine th

2.3² + √5.6 Help me please

Selective breeding is a process in which humans choose the genetic traits they want in the offspring of a plant or an animal. Parent organisms with the desired

What is the equation of the line that passes through the point (-2,14) and is perpendicular to the line with the following equation? y= -2/5 x-1

do most answers revive on average less than 50 inches of rain less than 10 inches of rain or less 1 inch of rain each year

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

what are the factors of -120

The height of a football t seconds after being thrown upward is given by the function h = - 167 + 64t + 5. w long will it take for the football to reach its max

please help me with this question! (first CORRECT answer gets brainliest)

See picture-multiple choice.