Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

can someone please help

As a result of a car accident, sari now has problems forming new memories of facts and events. sari's _____ was damaged in the car accident.

What set Pennsylvania apart from other colonies?

What operation do u use to find the cost of a drink and a popcorn for one person?

What addition doubles fact can help you find 4+3?

The name of the first great civilization in Mesopotamia was a. Egypt b. Sumer c. Tigris d. Euphrates

in what zone of the oceon are you most likely to spot dolphins

write a story to represent the division problem 6÷1/3

Which of the following factors renders a species more susceptible to disease and infertility? a. large genetic diversity b. inbreeding c. crossbreeding d. reces

An amusement park sells child and adult tickets at a ratio of 8:1, On Saturday, they sold 147 more child tickets thank adult tickets. How many tickets did the a