sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

This hero killed bandits in the same way they killed their victims? * a.Hercules b.Theseus c.Perseus d.Jason

Evaluate the given question

Which one is a function?

love versus self interest in Macbeth

Identify what part of the brain deals primarily with memory and learning, and explain the process by which we use memory to help us learn.

blends word blow + spurt = ?

Which oneeeeee?????????

what does a 1 do to your grade i have a 96 what will be my grade when im given a 1

Which writing encourages the action demonstrated in the timeline? Below is a timeline. Year Event 1918 Latvia declares independence 1940 Soviet Union takes ove

What is the most populated state in the U.S.?