sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

A reflex arc is controlled by the neurons within the _______________________.

The Torah consists of five books that include __________.

75% of 84 is what number

Which sentence has two antecedents and one pronoun? a. Gwen cannot go on her trip as she had planned. b. I do not mind doing taking out the trash. c. New Yor

Which of the following is not a river in Africa? a. Niger b. Tigris c. Zambezi d. Congo

Which nationality did Alexander the Great claim to be? A.Greek B.Roman C.Persian D.Aryan

What is 3.82 rounded to the nearest whole number

is believed that Paul was a martyr. Which answer best describes what this means?

Which nationality did Alexander the Great claim to be? A.Greek B.Roman C.Persian D.Aryan

Why are small leaves an adaptation in a desert environment? a. They trap less water. b. They minimize water loss. c. They absorb more light. d. They fall ou