katerinagr16 katerinagr16

15-05-2020
Mathematics

contestada

What is the solution to the system of linear equations graphed below?

(0,4)
(4, 1/2)
(1/2, 4)
(0,3)

first correct answer gets brainliest!

What is the solution to the system of linear equations graphed below044 1212 403first correct answer gets brainliest class=

Respuesta :

oparetaima2004 oparetaima2004

15-05-2020

I think the answer is (0,3)

Answer Link

Otras preguntas

DIVIDE THE FOLLOWING INTEGERS. A. -78/ 12 B. - 155 /-5 C. 100 /-4

Maggie lives on a street with 10 houses. The houses are numbered 1 to 10. If Maggie adds up all the house numbers that are lower than hers, the total is three t

Name two fluid technologies that make use of water.

When a dog runs, the dog's paws apply a backward force on the ground. According to Newton's 3rd Law of Motion, the dog moves forward because

In what three ways does the author use third-person narrative in this excerpt?In early April 1963, the Peace Ponies went to a massmeeting at Sixteenth Street Ba

How does anaphase i in meiosis differ from anaphase in mitosis?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

Why did Iran’s government waited until jimmy carter left office to release the hostages?

ANAGNOS: . . . It will no doubt be difficult for you there, Annie. But it has been difficult for you at our school too, hm? Gratifying, yes, when you came to us

what is a summary of chapter 6 of the outsiders?