TigerBoyAgrim
TigerBoyAgrim TigerBoyAgrim
  • 12-09-2020
  • Geography
contestada

what is resource conservation ​

Respuesta :

famee123arf
famee123arf famee123arf
  • 12-09-2020

Answer:

conversation of resource is resource conservation

Answer Link

Otras preguntas

The shorter leg of a right triangle is 8 centimeters less than the other leg. Find the length of the two legs if the hypotenuse is 40.
At a school, 40% of sixth grade students said that hip-hop is their favorite kind of music. If 100 sixth grade students prefer hip-hop music, how many sixth gra
how do I do identify calculate the area and perimeter for quadrilaterals
What role does the white space play in an effective technical document ? A)it tells the reader that the instructions have ended B)it lets the reader know where
If 5x^2 + y^4 = −9 then evaluate d^2y/dx^2 when x = 2 and y = 1. Round your answer to two decimal places.
Which of the following statements is true concerning the National Weather Service's ability to predict aerial flooding? A. They can give good advance warning of
The number of horses occupying stalls at the county fairgrounds can be modeled by the following function, where x represents the number of days since the first
Which communities do early colonizers form? Early colonizers result in the formation of communities.
The volume of a sphere is cubic inches. What is the circumference of the great circle of the sphere?
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’