nehamasani9 nehamasani9
  • 13-09-2020
  • Geography
contestada

The Midwest in the USA would best be described as a ________ region.

1. Formal
2. Functional
3. Percuptual

Respuesta :

m4r31
m4r31 m4r31
  • 14-09-2020
It would be a perceptual region.
Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Find the surface area of a grapefruit with circumference of 14 cm
Which of the following numbers of replications of an experiment would make the results most conclusive?A.4B.2C.14D.1
How did the use of landmines and fragmentation bombs make the war especially brutal for soldiers and civilians?
which act was passed as a response to the boston tea party? a) the coercive acts b) the declaratory act c) the tea act d) the quebec act
does anyone know how to do this
help with geometry questions 45 points
Does George Washington's account contradict or support the account in the newspaper? Give two examples to support your response.
Which line from the prologue of Romeo and Juliet reveals the ending of the play?
Which list places the magma types in order of decreasing viscosity? A. basaltic, rhyolitic, andesitic B. andesitic, basaltic, rhyolitic C. basaltic, andesitic,