gabrielleeparker gabrielleeparker
  • 15-09-2020
  • English
contestada

what the definition of Paleolithic

Respuesta :

estrellarod2013
estrellarod2013 estrellarod2013
  • 15-09-2020

Answer: a time period referring to the Stone Age

Explanation:

Answer Link

Otras preguntas

If a boy exhibits delayed, abnormal physical growth; heart problems; certain facial characteristics; and intellectual disability, he may be diagnosed with [blan
If Besty has 14 t-shirts and 8 pairs of pants, the ratio of pants to t-shirts is?
How many 1/3s are in 2
Neil has 3 partially full cans of white paint. They contain 1/3 gallon. 1/5 gallon and 1/2 gallon of paint about how many paint does Neil have in all?
Write 15.4 as a mixed number
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
Which of these is the concept that a unit's sales will follow an approximate bell-shaped curve versus a steady sales life?
what was Atticus' response to Bob Ewell?​
100 POINTS ALL SHORT ANSWERS WILL BE DELETED 1. Why do many historians regard the printing press as the most important invention of the past millennium? you res
If two distinct positive divisors of 64 are randomly selected, what is the probability that their sum will be less than 32?