kenzietillman1223 kenzietillman1223

12-10-2020
Mathematics

contestada

The diameter of a cylinder is 8cm and the height is 2. What is the Volume? (NOTE: V=r2h)

Respuesta :

jhansip1979 jhansip1979

12-10-2020

Step-by-step explanation:

diameter= 8

radius=diameter/2

=8/2

=4

height=2

Volume =r2h

=4*2*2

=16

therefore the volume of the cylinder is 16 cm^3

hope it helps u

pls mark it as the brainliest

Answer Link

Otras preguntas

List two careers and the roles they play in research and development

What does All capital letters mean

A student titrates an unknown amount of potassium hydrogen phthalate (KHC%H4O4, often abbreviated KHP) with 20.46 mL of a 0.1000-M NaOH solution. KHP (molar mas

Enumerate 5 Establishments that offers Food and beverage services.

Becky and lewis´s hamster cages have the same perimeter. Lewis´s cage has a length of 0.75 times becky´s cage. what is the width, w, of Lewis´s cage? Write your

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

2. PART B: Which detail from the text best supports the answer to Part A? a. "Once the massacre finally stopped, a difficult question arose: Was there a way to

Read the excerpt from It's Our World, Too!: Young Which statement best describes how Neto has been People Who Are Making a Difference. affected by the conflict

Nikola likes to play horseshoes, where players try to score a ringer by throwing a horseshoe so it lands around a post. A player gets 2 attempts each round. Let

Write a function for the tranformations described below: "The cubic function shifts 7 units right and 5 units up."