peliti27 peliti27

12-10-2020
Geography

contestada

Up until about 10,000 years ago, humans got their food by

Respuesta :

24sagather 24sagather

12-10-2020

Answer:

hunting

Explanation:

becuse to get food you must hunt animals

Answer Link

brooklynnplathrop brooklynnplathrop

12-10-2020

Answer:

Below

Explanation:

Until agriculture was developed around 10,000 years ago, all humans got their food by hunting, gathering, and fishing.

Answer Link

Otras preguntas

Which of the following is an example of the electrostatic force acting in an atom? A. A proton attracting an electron. B. An electron attracting another electro

Janie uses a reflecting tool to reflect Point B onto Point A. Which of the following statements are true about the line of reflection? 1. Reflection line is per

What property could substitute cd

The literary device that helps readers visualize is A. strong verbs. B. snap shots. C. line breaks. D.

Can someone help I'm so confused

Which element, if combined with sulfur, will have the greatest attraction for the sulfur electrons?

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

In 1989, the Revolution in Czechoslovakia was a nonviolent and peaceful exchange of power.

Which is the best definition of an Egyptian pylon? A. a massive gateway with sloped sides B. a tall, four-sided structure, with a pyramidal

If two angles are both vertical and supplementary, then the angles are A.)Obtuse B.)Right C.)Acute D.)Adjacent