imadeyoureadthis20 imadeyoureadthis20

12-10-2020
Mathematics

contestada

Solve the equation.
-36= -6(2x-14)

1. 10
2. 1.8
3. 24
4. 4

isn’t it some crazy long number?

Respuesta :

jaiiii22 jaiiii22

12-10-2020

The answer to your question is 4

Answer Link

Otras preguntas

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Read this excerpt from a speech given at a campaign event: Voters of the 29th District, I urge you to cast your vote for Harlan Hill for your next representativ

Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-

Which of the following best describes the flow of energy in the Everglades food web shown below? Diagram for an everglades food web. The food web contains the f

Simplify 5x^3/7x^3+x^4

This is legit 1st grade stuff help please lol

Which of the following sentences is correct in its choice to use or not use hyphens?

Carbon tetrachloride will have which shape? A) bent B) linear C) tetrahedral D) triangular

Joel had to pay 5% tax on a bill that was $51.70. how much did he pay total

3. Which of the following is the imaginary horizontal line, sometimes referred to as eye level, that divides your line of vision when you look straight ahead?