sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

In which career has the percentage of females increased dramatically since 1983?

Angelina spent $16 for 12 pieces of candy to take to a meeting she has $16 each chocolate bar cost two dollars and each lollypop cost for one dollar determine h

Of what did president hoover assure the nation on friday, october 25, 1929, the day after black thursday

What was a long-term impact of Marco Polo’s trips to China

Kimtoya and Sidney are participating in a long-distance bike tour. The rate at which Kimtoya is riding is represented by the equation y = 12.5x, where x is the

solve for the variable b. 5a(b - c ) = d

Iris had $900. She spent 22% of this amount on a mobile phone. How much did she pay for the mobile phone?

an example of dramatic irony in the ramayana

whats the answer to g(x)=x^2+15x+54

¿En qué país comen "tapas"? (1 point) Question 17 options: 1) Cuba 2) España 3) Colombia 4) Argentina