sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

In the myth, Arachne, why was Athena jealous of Arachne? Question 1 options: Arachne had a really cute boyfriend. Arachne was a better weaver than Athena.

What is the answer??

A lumber yard has five different lengths of 2 by 4 boards. Based on cost per linear foot, which is the best deal available on 2 by 4 boards at this lumber yard?

y = 3x - 10 is this equation linear or nonlinear?

anyone know how to do this????

What did Harding's return to normalcy program mean to Americans?

5. Higher Order Thinking Sean studies 16 fewer vocabulary words than Chris. Chris studies 10 fewer vocabulary words than Tia. Tia studies 34 words. How many wor

What Windows Server 2016 feature implements software defined storage and is intended to make storage more versatile by making it easier to add storage, access s

Your firm added three new products earlier this year to increase variety for customers. Two of them failed to reach even minimal sales. Which of the following i

20 POINTS! Please help, best answer will recessive brainliest answer points as well as 5 stars and a thank you. :)