i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Where can the site- specific works of each period be found?

What is force? A. A measure of how far an object moves B. The amount of energy an object has C. A push or a pull that transfers energy from one object to anothe

How does Senator Obama's use of the metaphor "beacon of freedom" reflect the purpose of inspiring the audience to take action in the upcoming election?

What kind of person is Cherry Valance? Use two pieces of evidence to support your answer from the book. (C.E.R)

I don't understand you can you help me to do it with the procedures and everything please

Copy and complete the table of values for y = 1/ What numbers replace A, B and C? x 0 0.1 0.2 0.5 1 2 y undefined 10 A B 1 C 4 0.25

In the peterson and peterson studies of the duration of short-term memory, as demonstrated in class, researchers were able to discover the duration of short-ter

How would you respond to the statement, “But I don't want that child in my classroom”? Students will explore implicit/explicit bias in the field of early childh

Monday 1 1.) Find the area of the shaded region. Explain or show your reasoning.

orion iron corporation tracks the number of units purchased and sold throughout each year but applies its inventory costing method at the end of the year, as if