i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Passing through the tunnel into the open air can be symbolically compared to _____. death awakening the seasons childbirth

How many pounds are there in 2 and 1 over 4 tons? (1 ton = 2000 pounds)

What are the steps to divide 336/7

1.Your personality is related to your career choice because it affects: a. the things you like to do. b. how you make decisions. c. how you react to people and

José is afraid to ask Tina on a date because he fears she will say no. José is experiencing

what is bigger 0.7 or 3/4

when food and water became hard to find, many early societies split up. true or false

What is the nearest thousand to 700,000

What type of evidence is used in this excerpt from "The Crisis, No.1" by Thomas Paine? I once felt all that kind of anger, which a man ought to feel, against th

Change the adjective below to a superlative by adding the appropriate ending (ísimo). bonita