kerikeri14 kerikeri14

13-10-2020
Biology

contestada

1. Why don't the planets fly out of the solar
system?

Respuesta :

13-10-2020

Answer: Gravity. The sun is rather large, so its gravity has a strong pull that keeps all the planets in order.

Explanation:

Answer Link

ndavis1103 ndavis1103

13-10-2020

Answer: because of the gravitational pull of the sun.

Explanation:

Answer Link

Otras preguntas

How do you inspect and test an abrasive wheel? A. Run the wheel at its fastest speed to see if is functional B. Tap it with a non-metallic instrument and lis

In certain years, the galapagos plants produce many tube-shaped flowers rich in nectar. identify the finch that

Energy used in organisms is called?

twenty more than half a number of 70.what is the number

What did the idea of Manifest Destiny encourage?

How was settlement affected at the western end of this railroad line?

Find the probability that aticket is drawn at leat once, if the draws were mae with replacement

Factor completely 9x^2-64 A. (3x-8)^2 B. (3x+8)(3x-8) C. (3x+8)(3x+8) D. (9x-8)^2

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

A right triangle has the hypotenuse c =12 cm and an angle A= 30degree. Find the length of side a, which is opposite angle A.