ortizkimberly ortizkimberly

14-10-2020
Mathematics

contestada

graph the following inequality |-2x-6|-4x <6

Respuesta :

emmafoy emmafoy

14-10-2020

Answer:

x > 0

Step-by-step explanation:

Tell if it works

Answer Link

Otras preguntas

8. Which of these inferences is best supported by Attorney O'Brien's statements on page 792 - A. O'Brien is concerned for her client's health and well-being. B.

Solve the problems. Prove:

hechos históricos del 12 de octubreayudaa

When an author uses a fable with a moral to present a message, what is the most likely purpose? (5 points) Group of answer choices A.) To teach B.) To persuade

1. Find the value of x and the perimeter of the square. 2X 7x - 15

i need this answer urgently Note: this is grade 6 maths

La cuarta parte de un número , disminuida en 17 ,es igual a 4 . Calcula la mitad de dicho número AYUDAAAAAAAAAAAAAAAAAAAAA INMEDIATO

How many pounds of apples must chris pick before Pam’s orchard is cheaper that david’s

What state of liquid does point a represent in the Rankine cycle? Saturated liquid, subcooled liquid, superheated liquid, or Sat. liquid vapor mix?

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.